http://www.nag.co.uk/welcome_iec.asp
IRIS explorer location
Thursday, January 12, 2006
Consensus trees and XML models
Read a lot of Felsensteins work on consensus trees.
Ml consensus tree methods "l" varies from 0% to 100% as a value that is used to determine if a group should be collapsed. e.g. l = 50%, so all groups that occur in more than 50% of the trees will be drawn in the final consensus tree. 50% is the value used in the Majority Rule Consensus Tree (MRCT) method. Obviously because anything over 50% has to be in the majority.
Still working on literature review, not sure how much i've written, but theres definitely some very core sections still to write.
Wanted to try out tree-like data structures in java today. Thought occured to me to create java data structures that represent all objects from phylogenetics. But it would need java which makes it a bad idea. A better idea was to create XML schema or models (or whatever the word is) for each entity within the great phylogenetic ontology.
I should try to do this above. I might try it for a DNA sequence.
Need to think about what elements a sequence needs, what are the elements, what are they called, what type are they, what data do they contain.
draft DNA sequence XML schema
ID TYPE DATA
---------------------------------------------
NAME STRING GI345642
LENGTH INTEGER 20
DNA STRING CATCGTCGATCTCGATCGAT
---------------------------------------------
transferring these between programs would make things a lot easier.
you would still need a parser for taking data from a prog and converting it to this and then putting it into this.
If we surround existing software with a transparent data transfer service we need a million interfaces to interconvert data. LOTS of boring text parsing. A waste of time.
We need a core set of components that all talk to each other using a standard defined ontology.
People would only use a system of this type if it had all the features they use, rather than trying to provide it for them. Tools should be made available that can put custom progs into the system. Or at a stretch tell people how to rewrite their software to work with system but this prob wouldn't work.
I should provide custom versions of the most popular software, e.g. blast, clustalW, phylip.
Big job really, but perhaps a toy system could work, I could use it to link units together each units having inputs and outputs. A bit like IRIS explorer.
Ml consensus tree methods "l" varies from 0% to 100% as a value that is used to determine if a group should be collapsed. e.g. l = 50%, so all groups that occur in more than 50% of the trees will be drawn in the final consensus tree. 50% is the value used in the Majority Rule Consensus Tree (MRCT) method. Obviously because anything over 50% has to be in the majority.
Still working on literature review, not sure how much i've written, but theres definitely some very core sections still to write.
Wanted to try out tree-like data structures in java today. Thought occured to me to create java data structures that represent all objects from phylogenetics. But it would need java which makes it a bad idea. A better idea was to create XML schema or models (or whatever the word is) for each entity within the great phylogenetic ontology.
I should try to do this above. I might try it for a DNA sequence.
Need to think about what elements a sequence needs, what are the elements, what are they called, what type are they, what data do they contain.
draft DNA sequence XML schema
ID TYPE DATA
---------------------------------------------
NAME STRING GI345642
LENGTH INTEGER 20
DNA STRING CATCGTCGATCTCGATCGAT
---------------------------------------------
transferring these between programs would make things a lot easier.
you would still need a parser for taking data from a prog and converting it to this and then putting it into this.
If we surround existing software with a transparent data transfer service we need a million interfaces to interconvert data. LOTS of boring text parsing. A waste of time.
We need a core set of components that all talk to each other using a standard defined ontology.
People would only use a system of this type if it had all the features they use, rather than trying to provide it for them. Tools should be made available that can put custom progs into the system. Or at a stretch tell people how to rewrite their software to work with system but this prob wouldn't work.
I should provide custom versions of the most popular software, e.g. blast, clustalW, phylip.
Big job really, but perhaps a toy system could work, I could use it to link units together each units having inputs and outputs. A bit like IRIS explorer.
Subscribe to:
Posts (Atom)
